Ethics statement

The guinea pig experiment, in addition to the second and third NHP study (ZMapp1, ZMapp2 and ZMapp) were performed at the National Microbiology Laboratory (NML) as described on Animal Use Document (AUD) #H-13-003, and has been approved by the Animal Care Committee (ACC) at the Canadian Science Center for Human and Animal Health (CSCHAH), in accordance with the guidelines outlined by the Canadian Council on Animal Care (CCAC). The first study with MB-003 in NHPs was performed at United States Army Medical Research Institute of Infectious Diseases (USAMRIID) under an Institutional Animal Care and Use Committee (IACUC) approved protocol in compliance with the Animal Welfare Act, Public Health Service Policy, and other federal statutes and regulations relating to animals and experiments involving animals. The facility where this research was conducted is accredited by The Association for Assessment and Accreditation of Laboratory Animal Care International and adheres to principles stated in the 8th edition of the Guide for the Care and Use of Laboratory Animals, National Research Council (2011; http://grants.nih.gov/grants/olaw/Guide-for-the-care-and-use-of-laboratory-animals.pdf).

Monoclonal antibody production

The large-scale production of mAb cocktails cZMAb, MB-003, ZMapp1, ZMapp2 and ZMapp in addition to control mAb 4E10 (anti-HIV) from N. benthamiana under GMP conditions was done by Kentucky BioProcessing (Owensboro, KY) as described previously13,15,31. The large-scale production of m4G7 was performed by the National Research Council (Montreal site) using a previously described protocol16.

Viruses

The challenge virus used in NHPs was Ebola virus H.sapiens-tc/COD/1995/Kikwit-9510621 (EBOV-K) (order Mononegavirales, family Filoviridae, species Zaire ebolavirus; GenBank accession no. AY354458)18. Passage three from the original stock was used for the studies at the NML and passage four was used for the study performed at USAMRIID (the NHP study with the individual MB-003 mAbs). Sequencing of 112 clones from the passage three stock virus revealed that the population ratio of 7U:8U in the EBOV GP editing site was 80:20; sequencing for the passage four stock virus was not performed, and therefore the ratio of 7U:8U in the editing site was unknown. The virus used in guinea pig studies was guinea-pig-adapted EBOV, Ebola virus VECTOR/C.porcellus-lab/COD/1976/Mayinga-GPA (EBOV-M-GPA) (order Mononegavirales, family Filoviridae, species Zaire ebolavirus; GenBank accession number AF272001.1)32. The Guinean variant used in IgG ELISA and neutralizing antibody assays was Ebola virus H.sapiens-tc/GIN/2014/Gueckedou-C05 (EBOV-G) (order Mononegavirales, family Filoviridae, species Zaire ebolavirus; GenBank accession no. KJ660348.1)2.

Animals

Outbred 6–8-week-old female Hartley strain guinea pigs (Charles River) were used for these studies. Animals were infected intraperitoneally with 1,000 × LD 50 of EBOV-M-GPA. The animals were then treated with one dose of ZMAb, MB-003, ZMapp1, ZMapp2, c13C6, h13F6 or c6D8 totalling 5 mg per guinea pig, and monitored every day for 28 days for survival, weight and clinical symptoms. This study was not blinded, and no animals were excluded from the analysis.

For the MB-003 study performed at USAMRIID, thirteen rhesus macaques (Macaca mulatta) were obtained from the USAMRIID primate holding facility, ranging from 5.1 to 10 kg. This study was not blinded, and no animals were excluded from the analysis. Animals were given standard monkey chow, primate treats, fruits, and vegetables for the duration of the study. All animals were challenged intramuscularly with a target dose of 1,000 p.f.u. Treatment with either monoclonal antibody, MB-003 cocktail, or PBS was administered on 1, 4, and 7 dpi via saphenous intravenous infusion. Animals were monitored at least once daily for changes in health, diet, behaviour, and appearance. Animals were sampled for chemical analysis, complete bloods counts and viraemia on 0, 3, 5, 7, 10, 14, 21, and 28 dpi.

For the ZMapp1 and ZMapp2 study, fourteen male and female rhesus macaques (Macaca mulatta), ranging from 4.1 to 9.6 kg (4–8 years old) were purchased from Primgen (USA). This study was not blinded, and no animals were excluded from the analysis. Animals were assigned groups based on gender and weight. Animals were fed standard monkey chow, fruits, vegetables, and treats. Husbandry enrichment consisted of visual stimulation and commercial toys. All animals were challenged intramuscularly with a high dose of EBOV (backtitre: 4,000 × TCID 50 or 2,512 p.f.u.) at 0 dpi. Administration of the first treatment dose was initiated at 3 dpi, with identical doses at 6 and 9 dpi. Animals were scored daily for signs of disease, in addition to changes in food and water consumption. On designated treatment days in addition to 14, 21, and 27 dpi, the rectal temperature and clinical score were measured, and the following were sampled: blood for serum biochemistry and cell counts and viraemia. This study was not blinded, and no animals were excluded from the analysis.

For the ZMapp study, twenty-one male rhesus macaques, ranging from 2.5 to 3.5 kg (2 years old) were purchased from Primgen (USA). This study was not blinded, and no animals were excluded from the analysis. Animals were assigned groups based on gender and weight. Animals were fed standard monkey chow, fruits, vegetables, and treats. Husbandry enrichment consisted of visual stimulation and commercial toys. All animals were challenged intramuscularly with EBOV (backtitre: 1,000 × TCID 50 or 628 p.f.u.) at 0 dpi. Administration of the first treatment dose was initiated at 3, 4 or 5 dpi, with two additional identical doses spaced 3 days apart. Animals were scored daily for signs of disease, in addition to changes in food and water consumption. On designated treatment days in addition to 14, 21, and 28 dpi, the rectal temperature and clinical score were measured, and the following were sampled: blood for serum biochemistry and cell counts and viraemia.

Blood counts and blood biochemistry

Complete blood counts were performed with the VetScan HM5 (Abaxis Veterinary Diagnostics). The following parameters were shown in the figures: levels of white blood cells, lymphocytes, percentage of lymphocytes, levels of platelets, neutrophils and percentage of neutrophils. Blood biochemistry was performed with the VetScan VS2 (Abaxis Veterinary Diagnostics). The following parameters were shown in the figures: levels of alkaline phosphatase, alanine aminotransferase, blood urea nitrogen, creatinine, total bilirubin and glucose.

Enzyme-linked immunosorbent assays (ELISAs)

IgG ELISA with c13C6, c2G4 or c1H3 was performed as described previously16 using gamma-irradiated EBOV-G and EBOV-K virions purified on a 20% sucrose cushion as the capture antigen in the ELISA. Each mAb was assayed in triplicate.

Neutralizing antibody assays

Twofold dilutions of c13C6, c2G4 or c1H3 ranging from 0.0156 to 2 μg ml−1 were first incubated with 100 p.f.u. of EBOV-G at room temperature for 1 h with or without complement, transferred to Vero E6 cells and incubated at 37 °C for 1 h, and then replaced with DMEM supplemented with 2% fetal bovine serum and scored for the presence of cytopathic effect at 14 dpi. The lowest concentrations of mAbs demonstrating the absence of cytopathic effect were averaged and reported.

EBOV titration by TCID 50 and RT–qPCR

Titration of live EBOV was determined by adding tenfold serial dilutions of whole blood to VeroE6 cells, with three replicates per dilution. The plates were scored for cytopathic effect at 14 dpi, and titres were calculated with the Reed and Muench method33. Results were shown as median tissue culture infectious dose (TCID 50 ).

For titres measured by RT–qPCR, total RNA was extracted from whole blood with the QIAmp Viral RNA Mini Kit (Qiagen). EBOV was detected with the LightCycler 480 RNA Master Hydrolysis Probes (Roche) kit, with the RNA polymerase (nucleotides 16472 to 16538, AF086833) as the target gene. The reaction conditions were as follows: 63 °C for 3 min, 95 °C for 30 s, and cycling of 95 °C for 15 s, 60 °C for 30 s for 45 cycles on the ABI StepOnePlus. The lower detection limit for this assay is 86 genome equivalents ml−1. The sequences of primers used were as follows: EBOVLF2 (CAGCCAGCAATTTCTTCCAT), EBOVLR2 (TTTCGGTTGCTGTTTCTGTG), and EBOVLP2FAM (FAM-ATCATTGGCGTACTGGAGGAGCAG-BHQ1).

Sequence alignment

Protein sequences for EBOV-K and EBOV-G surface glycoproteins were obtained from GenBank, accession numbers AGB56794.1 and AHX24667.1 respectively. The sequences were aligned using DNASTAR Lasergene 10 MEGAlign using the Clustal W algorithm.

Statistical analysis

For the guinea pig and nonhuman primate studies, each treatment group consisted of six animals. Assuming a significance threshold of 0.05, a sample size of six per group will give >80% power to detect a difference in survival proportions between the treatment (83% survival or higher) and the control group using a one-tailed Fisher's exact test.